RNA isolation and real-time qPCR
Total RNA was isolated using TRIzol Reagent (Vazyme Biotech, China),
based on the chloroform method. cDNA was synthesized according to the
manufacturer’s instructions using the HiScript III RT SuperMix for qPCR
(+gDNA wiper) (Vazyme
Biotech,
China). Quantitative PCR was performed using the AceQ qPCR SYBR Green
Master Mix (High ROX Premixed, Vazyme). The relative expression of each
gene was determined and normalized to the expression of the housekeeping
gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and calculated
using the 2–ΔΔCT method.
Primer sequences for gene expression were as follows:
Tnf-𝛂 : Forward primer: CCTGTAGCCCACGTCGTAG; reverse primer:
GGGAGTAGACAAGGTACAACCC.
Baff : Forward primer: ACACTGCCCAACAATTCCTG; reverse primer:
TCGTCTCCGTTGCGTGAAATC.
Gapdh : Forward primer: AGGTCGGTGTGAACGGATTTG; reverse primer:
GGGGTCGTTGATGGCAACA.