Generation of single mutant H9N2-AIVs by reverse genetics
Total RNA extraction and reverse transcription (RT) reactions of
CQY-2014 were performed as previously reported (Xia et al., 2016). PCR
amplification of the 8 gene fragments (PB2, PB1, PA, NP, NS, M, NA and
HA) were carried out using the primers presented in Table S2. PCR
products were sequenced by Shanghai Sangong Biological Engineering
Technology & Services Co., Ltd. (Shanghai, China). Complete genome
sequences were submitted to GenBank under the accession numbers
MW493190-MW493196 and MW493229.
For the construction of recombinant plasmids, a classical cloning method
was used as previously described (Hoffmann, Stech, Guan, Webster, &
Perez, 2001). In brief, the 8 purified complete genome fragments were
cloned into the dual-promoter plasmid pHW2000 by homologous
recombination, and transformed into E.coli TOP10 competent cells.
Homologous recombinant primers are presented in Table S2. The linearized
pHW2000 plasmid was prepared by PCR amplification using the primers
pHW2000F: CCCCCCCAACTTCGGAGGTC and pHW2000R: AATAACCCGGCGGCCCAAAA.
Recombination was performed according to the SE seamless cloning and
assembly kit instructions (Beijing Zoman Biotechnology, China). The
single pre-selection substitutions were separately introduced into the
HA1 gene of the CQY-2014 virus using TaKaRa MutanBEST kit (TaKaRa,
Japan) according to the manufacturer’s instructions. At least 4 clones
were picked for each transformation pool of recombinant plasmid, and was
sequenced to ensure the absence of unwanted mutations. Viral rescue was
performed by transfecting 293T cells with plasmid prepared using the
LipofectamineTM 3000 Reagent Protocol kit (Thermo
Fisher Scientific, China). The supernatant and cell mixture were
harvested after 48 h of culture and blind passaged in MDCK cells for 3
generations. Hemagglutination test and RT-PCR were used to identify the
rescued viruses.